jakailenmumpfield2 jakailenmumpfield2

02-03-2020
Social Studies

contestada

Which country was split, and how was it divided?

Respuesta :

VeriVeryfangirl VeriVeryfangirl

02-03-2020

North and South Korea split after WW2. It was divided because the Americans controlled south of the line - the Russians installed a communist regime in the north, later ceding influence to China.

Answer Link

Otras preguntas

In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front

How well did feudalism establish order in the Middle ages?

Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number

The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The

Can someone answer my question plz!!!! It's in the picture and show your work!!!!!

Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

find the prime factorization 504

There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t

Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.