katie84878393 katie84878393

02-04-2020
Mathematics

contestada

if 4 inches represents 6 feet how many feet represent 1 inch

Respuesta :

angelinabaker92803 angelinabaker92803

02-04-2020

The answer is 1 and 1/2 feet

Answer Link

Otras preguntas

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Describe how to work with others to develop a plan to support an individual to negotiate an environment

Given these what is X if B-X=A

Please help, I'll give brainliest asap if it's right Describe the seven steps a state budget must go through in order to go into effect.

This U.S. president in the 1970s believed in revenue sharing, which spread money to federal, state, and local governments. A. Richard Nixon B. Lyndon Johnson C.

will give brainliest, 5 stars, and a thanks In the feudalism government, the jobs of nobles was to a. control the fiefs/land b. gain land c. defend the land d.

Jordan starts his day by doing his exercises. Jordan jumps rope for 10 minutes and lifts weights for 30 minutes. Jordan runs 10 miles in 40 minutes, which is 0.

can someone help me with this question

A package of meat weighs 3.5 pounds. The price per pound is $1.50. What is the price of this package?

Large numbers of skilled workers left Iran in the early 21st century, primarily because __________. A. The use of their skills was outlawed by Iran's Islamic go