jmgonzalezsolis jmgonzalezsolis

03-06-2020
Biology

contestada

Justify cellular respiration is a recycling of carbon in the carbon cycle.

Respuesta :

Charmber06 Charmber06

06-06-2020

Answer:

The carbon cycle shows how atoms of carbon can exist within different compounds at different times and be recycled between living organisms and the environment.

Answer Link

Otras preguntas

need help anybody know how to do this

Which Romantic poet said, “I think I shall be among the English Poets after my death,” before dying of tuberculosis at 25? A. Lord Byron B. Samuel Coleridge

What is mitochondria

Which of the following best describes the rights given to the citizens of Jamestown by the Virginia Charter of 1606?

The word biology means the study of _____. plants animals organisms life

*The sum of two numbers is 400. If the first number is decreased by 20% and the second number is decreased by 15%, then the sum would be 68 less. Find the numbe

Boris has scored 80, 93, 63, 83, and 83 on his previous five tests. what score does he need on his next test so that his average (mean) is 79?

Studies of populations that reveal correlations between dietary habits and disease incidence are

U.s. president woodrow wilson's fourteen points was a proposal based on what post-war principle?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat