sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

Choose the correct pair of expressions to complete the solution

In 1810, about bales of cotton were produced in the United States. Fifty years later, the production of cotton had From 1810 to 1860, the population of enslaved

HEY CAN ANYONE PLS ANSWER DIS!!!!!!

Were the mongols beneficial or harmful to Eurasia? (Europe and Asia)

(I need this ASAP) What is one of the key purposes of African folktales? O to separate fact from opinion O to share stories with other cultures to describe even

Describe one of the symbols in "Everyday Use." Explain how the author uses this symbol to convey the theme of the story.

please give the right answer!!

Each issue of Soccer World magazine costs $5.99 at the book store. A 6-month subscription costs $24.99. How much can a reader save by subscribing to the magazin

tonya runs 8 kilometers in 60 minutes. at this rate, how long would it take her to run 2 kilometers?

Which type of account (real, personal, or nominal) includes the following expenses of a business? Expenses like rent, transportation, and advertising are part o