malalala50
malalala50 malalala50
  • 01-11-2020
  • English
contestada

............................... nothing now...

Respuesta :

aondokelly
aondokelly aondokelly
  • 04-01-2021

Answer:

what goes around comes around

Explanation:

now...

Answer Link

Otras preguntas

y = 4x^3– 20x^2+ 25x
How is a species’ population dynamics affected by the presence of another species with the same niche?
It is not _[blank] to make a snowman if you do not wear a coat while outside. Which word best completes the sentence? O plausible O ethical O prudent O benevole
What type of decimal is this fraction: 11/201.Group of answer choices2.repeating3.neither4.both5.terminating
Escriba los pasados de los siguientes verbos . 1. Go___________________________ 2. Beat_________________________ 3. Bring________________________ 4. Walk_______
Which of these are considered characteristics of gangs? Select the three correct answers. A. A designated leader B. A territory C. Recurrent interactions among
Find the missing angle measures:
The American Revolution in colonial North America between 1765 and 1783 was a time of excitement, fear and uncertainty. As a student of your current age, imagin
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
helo guys i need help with this question