HollyWood101
HollyWood101 HollyWood101
  • 03-10-2016
  • English
contestada

What is star wars about people

What is star wars about people class=

Respuesta :

MeMyselfAndTheAnswer MeMyselfAndTheAnswer
  • 03-10-2016
star wars is about luke and stuff and they afe in space
Answer Link
delarosasimone
delarosasimone delarosasimone
  • 03-10-2016

The entire 6 movie story is about the rise, fall and redemption of Anakin Skywalker.
Answer Link

Otras preguntas

How has water influenced the development of civilization in Africa
How do I do trebuchet calculations????? Help me please
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number