johnsanchez2008 johnsanchez2008

04-03-2021
Mathematics

contestada

find the area of the composite shape. quickly please

find the area of the composite shape quickly please class=

Respuesta :

aubriestinson2027 aubriestinson2027

05-03-2021

Answer:

4800 1 x 24 x 25 x 8

Step-by-step explanation: 1 x 24 x 25 x 8

Answer Link

Otras preguntas

Which weighs more? a.they both weight exactly the same. b.four protons c.two neutrons and two protons in a helium nucleus?

Firms can use one, no more than two, of five entry modes to enter into international markets. Exporting, Licensing, Strategic Alliances, Acquisitions, and newly

Can you help me to find this answer, please, I need help

If a solute dissolves in an endothermic process select one: a. hydrogen bonds must exist between solvent and solute. b. strong ion-dipole forces must exist in t

if 2^x-4=4a^x-6 what is the value of a

epistrophe literary definition

Many obstetricians date the onset of pregnancy from the date: select one: a. of conception. b. of the woman's last menstrual period. c. of implantation. d. when

A sharp type of pain from the abdomen that travels along neural routes

What US policy was designed to handle the threat of communism spreading to the Middle East in the 1950s? A. The Kennan plan B. The Middle East doctrine C. Th

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat