s1831583 s1831583
  • 02-06-2021
  • Health
contestada

an exercise stress test might be used when

Respuesta :

24jblanco03035
24jblanco03035 24jblanco03035
  • 02-06-2021

Answer:

it is primarily used to help your doctor determine if your heart receives enough oxygen and proper blood flow when it needs it most, such as when you are excercising.

Explanation:

hope the helps

have a great day/night

Answer Link

Otras preguntas

Agriculture accounted for more workers in the West than any other occupation. True False
3. In __________ for German attacks on their cities, the French bombed the German city of Baden. a. omnivorous b. multifarious c. reprisal d. decrepit 4. He ___
What does it mean to appreciate culture
8.Sarah works at a shoe store. She earns a base salary of $1,500 per month, plus a 25% commission on the amount of shoe sales she makes during the month. If Sar
Compare and contrast Benvolio and Mercutio.
What is the common ratio of the sequence?
For g(x) = 3(64)*, find the following. g(-1/3)
What system in India emphasizes the division of labor? a-the caste system b- karma c-policy of neutrality d-urbanization
4. A simple sugar's properties result from a. Its ratio of amylose to amylopectin b. How atoms are arranged in its molecules C. The type of plant that produced
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template