jesusfabian24 jesusfabian24
  • 01-12-2021
  • Mathematics
contestada

The hanger image below represents a balanced equation.
27
V
Find the value of v that makes the equation true.
U =
I need the answer

The hanger image below represents a balanced equation 27 V Find the value of v that makes the equation true U I need the answer class=

Respuesta :

ilikebrea2
ilikebrea2 ilikebrea2
  • 01-12-2021

Answer:

2x =3

The hanger image given in the figure represents balanced equation.

Then we have to write an equation to represent the image.

In balanced form left side = right side

x + x = 1 + 1 + 1

2x = 3

Answer Link

Otras preguntas

Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG
metswementfollowing meas,Express cach of thein lowest terms,wto2.S.60​
Read this dictionary entry for the word domain. domain (doh-mayn) n. 1.complete and absolute ownership of land 2.a region distinctively marked by some physical
Mr.Cho made a two way table to describe members of his family.which could describe the row and column headings for Mr.Chos table
1) What are some potential problems or risks of relying on the information provided by anonymous 9-1-1 callers to serve as proof of impending criminal activity?
What is the rate of change (86, 124) (64, 113)
Is -5 a rational number
help plsssssssssssssssssssssss again
Why does hazardous waste require special handling?
Joe is looking for a new laptop case. His computer is 18 x 13.5 inches. What is the perimeter and area of the laptop case? Perimeter: Area: