BillyQ346416 BillyQ346416
  • 03-11-2022
  • Mathematics
contestada

Evaluate 2x+y, if x=1 and y=-3

Respuesta :

ChristianneG772223 ChristianneG772223
  • 03-11-2022

x=1

y=-3

required to evaluate 2x+y

We therefore substitute for x and y in the above expression

2(1) + (-3) = 2 - 3 = -1

Answer Link

Otras preguntas

Your religious identity is only important for you within your family and does not matter in the public sphere.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
what is the relationship between hitech and hipaa
Help! Exponential Equation WITHOUT CALCULATOR
How did president franklin roosevelt respond to adolf hitler's attack on the soviet union in june 1941?
The basis of freedom of religion is found in which two principles in the bill of rights
9 students can make a poster in 10 hours. How many students should join them so that they all together can make this poster in 6 hours
__________ is widely considered to be the founder of the professional american police department.
How would you describe neville chamberlain's policy toward hitler in the late 1930?
Suppose Naomi gets a sales bonus at her place of work that gives her an extra $600 disposable income. She chooses to spend $360 and save the remaining $240. Fr