JaquaiW132278 JaquaiW132278
  • 03-11-2022
  • Mathematics
contestada

Which angle forms a linear pair with

Which angle forms a linear pair with class=

Respuesta :

AvramN137157 AvramN137157
  • 03-11-2022

A linear pair angle must add up to 180 degrees. The angle that form a linear pair with angle MON is expressed below

[tex]\begin{gathered} \angle MON+\angle QOM=180\text{ degre}es \\ \text{therefore} \\ \angle MON\text{ and }\angle QOM\text{ are linear pair} \end{gathered}[/tex]

Answer Link

Otras preguntas

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10
am example of a mechanical wave is?
The type of survey system that is based on sets of intersecting lines, which are principal meridians and base lines, is known as?
One of the steps in the commercial process for converting ammonia to nitric acid is the conversion of NH3 to NO: 4NH3 (g) 5O2 (g)--> 4NO (g) 6H2O (g) In a ce
does (x+1) squared minus x squared equal 2x+1
You are told that the sampled signal sent by a source is 2 seconds long and has 8000 samples per second. The signal is x[n]______.
Reviewing Key Ideas 1. Give two reasons why nonverbal communication is important to the creation of meaning.
which element, when combined with chlorine would most likely form an ionic compound? potassium carbon phosphorus chlorine
In a study, the sample is chosen by asking people on the street What is the sampling method? A. Simple Random B. Systematic C. Stratified D. Cluster E. Convenie
Is making ice cream a physical or chemical change