OregelNando OregelNando

01-05-2017
Biology

contestada

Most homeostatic systems are ____? extrinsic, intrinsic, both, none of the above

Respuesta :

XXDEADINSIDEXX XXDEADINSIDEXX

01-05-2017

Both my friend both is it

Answer Link

Otras preguntas

What is the lowest level of measurement that a median can be computed?

Which style of art is distinguished by texture oli paint ,solid forms suggested by shape imprecise lines ,and intermingled colors

Do you think there are benefits to teaching prisoners about philosophy?

which of the following statements agrees with the second law of thermodynamics

Every month Tristan deposits $488 into an interest-bearing account to save for a down payment on a house. The interest rate on the account is 5.27% compounding

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What can be inferred about the Cyclops in this excerpt from Homer’s Odyssey? The land of Cyclops first, a savage kind, Nor tamed by manners, nor by laws confine

What caused the gross domestic product of the united states to quadruple between 1860 and 1890?

_______________ exposure to radiation can increase the risk of cancer.

Question 16 (5 points) How are the two angles related? Question 16 options: adjacent complementary supplementary vertical