allendaniel277
allendaniel277 allendaniel277
  • 04-06-2018
  • Mathematics
contestada

Solve for x.

[tex] 6-2x-x=18 [/tex]

Solve for x tex 62xx18 tex class=

Respuesta :

meespinozafl
meespinozafl meespinozafl
  • 04-06-2018
b because 18-6 = 12 and -2-x=-3x so then it will equal to -3x=12 divided by -3 and your answer is -4 so that means B


Answer Link

Otras preguntas

what is 34% out of 35????
Unit 3 parallel and perpendicular lines Homework 3 proving lines are parallel
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Choose the measures of center that you can find from this data display.1). Mean2). Mode3). None of them4). Median
86.934 rounded to 2 significant figure
what is a/3+4=6? I can't figure it out!
What is the value value of the discriminant of 2x2 = 24 ?
8/12 as common factor
Please help serious answers only
(5x 2 −9x+11)−(−2x 2 +3x−2=