junior2551 junior2551
  • 03-06-2016
  • Social Studies
contestada

what did overproduction of consumer good and farm product have to do with the beginning of the great depression

Respuesta :

mathsucks14
mathsucks14 mathsucks14
  • 03-06-2016
The farmers were in a depression before the actual "Great Depression". Because of the high prices and the overproduction. 
Answer Link

Otras preguntas

Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
The section of the small intestine between the duodenum and ilium?
Tu as quels cours le jeudi matin?
A generator stores electric current. Explain why you agree or disagree with this statement
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung