OofHomeSchool
OofHomeSchool OofHomeSchool
  • 02-12-2019
  • Mathematics
contestada

Which term best describes the relationship between time and number of labels printed?

A. double

B. decreasing

C. proportional

Which term best describes the relationship between time and number of labels printed A double B decreasing C proportional class=

Respuesta :

lilgunter12
lilgunter12 lilgunter12
  • 02-12-2019

Answer:

C proportional

Step-by-step explanation:

The answer is c because

proportional means equal

and as u can see in the photo you have represented a proportional relationship because ther line is going in and equal line across the axis and it is increasing at a proportional rate!

and there you go!

Answer Link

Otras preguntas

Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
Susan ........ (Run) to school because she was late.
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
What would be the most likely effect of one company buying a competitor?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
How do you put allele in a sentence
How to change 3 7/8 into an improper fraction