Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

(please help me out D: ) (I screenshot the question and answer)

Being optimistic, expressing your commitment, emotional support and seeking support from family and friends are all examples of: Being nice Being human Communi

Copernicus and other astronomers before him thought that celestial bodies followed a _____ orbital path.

Josiah and his friends are going to the movies. Each ticket costs $10, and popcorn is $5 a bag. There is a $3 service fee for the entire purchase. He has $75. I

Which volcano erupted in the Pacific Northwest in 1980? A. Mount Rainier B. Mount Vesuvius C. Mount Pinatubo D. Mount Saint Helens

In mold fossils, the entire body of the organism is preserved. a. True b. False

How can flooding be beneficial for agriculture?

Make up a word problem for y = 50+4x

During the Vietnam war, more than 2 million Americans served. a. True b. False

Migration is a behavior that is usually influenced by a. changing seasons. b. the phase of the moon. c. the rise and fall of tides. d. the time of day.