sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

2. What role has globalization played?

Which of the following functions is quadratic? O A. f(x) = 7x(x+3) OB fx) = 5/x-1 O c. f(x) = 2^2 O D. f(x)=3(4 – x)

SOS PLEASE HELP ME!!! Which statement can be used to compare the characteristics of the functions?

What is the inverse of f(x) = 1x+2?h(x) = 1x+2h(x) = -x-2h(x) = 3x - 2Oh(x) = 3x - 6

What was representation in South Carolina house

Pls answer ASAP. EXPLAIN

A sample of gas is held at 100oc at a volume of 20 L.if the volume is increased to 40 L what is the new temperature of the gas in celcius.

Which of the following are characteristics of organisms in the Kingdom Plantae? *help i can't get this question wrong

Tom's tank hold 12.5gallons of gas. Ifgas costs $1.96 pergallon, how much wilIt cost to fill histank?1

Modeling with Exponential and Other Functions Challenge: According to legend, Sissa Ben Dahir, the Vizier of the court of King Shirham of India, worked diligent