canddace1026 canddace1026

03-09-2016
Biology

contestada

Why does the maple tree produce wood strong enough to use as furniture?

Respuesta :

gerzimthomas201 gerzimthomas201

03-09-2016

It survives such tough weather that they expand and become stronger so they could use to make furniture

Answer Link

charlym charlym

03-09-2016

Yes. It is strong enough

Answer Link

Otras preguntas

Gerri says that a spider use their fangs for the same purpose that crustaceans use their claws. Alana disagrees and says that spiders use their fangs for the s

what was a power given by the articles of confederation

can you guys help me with this simple math problem ?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Definition: an event that is made up of two or more outcomes is called ____.

Arrange the complex numbers in order according to the quadrant in which they appear, starting with the first quadrant. Tiles: 3 − 4i -1 − 3i 4 + i -2 + 2i

Why is plagiarism a violation of ethics? a. it makes psychology researchers look bad. b. it violates an apa standard. c. it is akin to lying. d. it violates a b

At a fast food restaurant, four friends each ordered a sandwich for $4.89 each and a drink for $1.69. What is the best estimate of the amount of change they wil

which of the following statements agrees with the second law of thermodynamics

The wealth and prosperity of mali and songhai were dependent on controlling the trade in