jalayaha1 jalayaha1

01-01-2021
Mathematics

contestada

Find the percent of change.
Round to the nearest percent.
Original: 30%
New: 150

Respuesta :

heahama21 heahama21

05-01-2021

Answer: 100+500=600% or $

Step-by-step explanation: u have to be

Answer Link

Otras preguntas

Find the equation of a line passing through the point (−3, 5) and making an angle of 16° with the x-axis

Name a few important body functions that your nervous system controls on its own without you having to think about it much?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

epistrophe literary definition

Lisa creates a scatter plot of the number of minutes she runs on the treadmill and the calories she burns. About how many more calories does she burn for every

Which is the best way to conserve worldwide freshwater resources? 1.increase the amount of land used to raise cattle 2.use more efficient irrigation technique

How far away is the next Earth-like planet in light years? What does this seem unlikely that it won’t be a manned space mission?

What are some quotes in macbeth that show he is ambitious?

Three students are chosen from 6 males and 4 females how many ways are there for mary to go on the trip

Which phrase best describes the New World Order?