iiHybrid
iiHybrid iiHybrid
  • 01-05-2021
  • Mathematics
contestada

This is due at 11:59 tonight please help meh and explain your reasoning ( •᷄ - •᷅ )​

This is due at 1159 tonight please help meh and explain your reasoning class=

Respuesta :

abidemiokin
abidemiokin abidemiokin
  • 06-05-2021

Answer:

44.375sq.cm

Step-by-step explanation:

The Area of the figure = Area of the square - Area of the quadrant

Area of the square = 8 * 8 = 64sq. cm

Area of the quadrant = πr²/4 = 3.14(5)²/4

Area of the quadrant = 19.625sq.cm

Area of the figure = 64 - 19.625

Area of the figure  = 44.375sq.cm

Answer Link

Otras preguntas

NEED HELP ASAPPPPPPP
Find the product. (7x-2) (x+y)
Homosociality reflects children's tendency to prefer social interactions with
What is the distance between points (-42, 63) and (-39, 67)?
Separation of ownership and control creates an agency problem when an agent pursues goals that conflict with the principals' goals. Principals establish and use
The moon can always be seen from every part of the earth. This is a(n) ____________statement. a. Qualified c. Neither of these b. Absolute d. Both of these
How might the history of korea have been different if united nations forces had not stepped into oppose the north korean invasion in 1950?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
a school cafeteria makes 4 diffrent salads during the week but serves only 2 salads each day on a roating basis. salads: chicken,fruit,pasta,tuna. a student ran
If 2/3 + 6 = 7/6p, what is the value of p?