01067416q 01067416q

01-12-2016
Mathematics

contestada

name the property of real numbers illustrated by the equation step by step

-10+4=4+(-10)

Respuesta :

MatCauthon MatCauthon

01-12-2016

That illustrates the commutative property of addition. This property is technically
a + b = b + a.
In this case, you are using -10 for a, and 4 for b.

The Commutative Property of Addition.

Answer Link

Faintlilly Faintlilly

01-12-2016

The Commutative property of addition i think

Answer Link

Otras preguntas

#15 Which phrase in this passage indicates Andrew Carnegie’s support for Social Darwinism? A. “it insures the survival of the fittest in every department” B. “w

Out of 310 racers who started the marathon, 286 completed the race, 19 gave up, and 5 were disqualified. What percentage did not complete the marathon?

Oregon has more ghost towns than any other U.S. state. True or false

3p - 2(p-4) = 7p + 6

Can someone help with this !!

How many grams of ethylene glycol (C2H6O2) must be added to 1.15 kg of water to produce a solution that freezes at -4.46Â°C?

Willow Springs produces various wooden bookcases, tables, storage units, and chairs. Which of the following would be included in a listing of the company's non-

Can anyone help me pls begging u

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10

PLease help me ASAP and show your work. SHOW YOUR WORK FOR BOTH