jiajinghuang5089 jiajinghuang5089

03-11-2021
History

contestada

the ghana empire created extensive trade networks across the sahara desert, sending out caravans bearing

Respuesta :

8paulie8 8paulie8

03-11-2021

Answer:

Salt and Gold

Explanation:

Answer Link

Otras preguntas

The representative of the reigning monarch of the United Kingdom in both Australia and New Zealand is called the __________. A. prime minister B. governor gener

Store supplies still available at fiscal year-end amount to $2,050. Expired insurance, an administrative expense, for the fiscal year is $1,600. Depreciation ex

4. When -2 is substituted for x, in the equation y=2x+1, what is y? Show work.

what is a food technologist

A credit card company wants to test the hypothesis that its account holders spend an average of $100 per month at gasoline stations. They take a sample of 1000

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

The manager of Calypso, Inc. is considering raising its current price of $30 per unit by 10%. If she does so, she estimates that demand will decrease by 20,000

3. Choose a well-known company, and describe what you think that company's target market is. How can you tell? (1-5 sentences. 3.0 points) TIP: This can be the

You are part of the response to a motor vehicle collision on a busy highway. There are multiple vehicles involved and multiple casualties. The police and local

Do all recessive traits always skip one generation?