TrillCandii5547 TrillCandii5547
  • 03-11-2017
  • Chemistry
contestada

A chemical ________________ is a substance formed by the chemical combination of two or more elements.

Respuesta :

meatymeat
meatymeat meatymeat
  • 03-11-2017
A chemical compound is a substance formed by the chemical combination of two or more elements. I hope this fulfills your inquiry, and if you require further assistance feel free to ask. 
Answer Link
Аноним Аноним
  • 03-11-2017
The missing will be compound.

Chemical compound is a substance formed by the chemical combination of two or more elements
Answer Link

Otras preguntas

Through what system is glucose delievered to cells for cellular respiration
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What did president wilson's wife make sure was on the white house lawn?
Do cones and polyhedrons both have only one base true or false
__________ is widely considered to be the founder of the professional american police department.
In 500 words, explain how the characters of Jem and Scout develop over the course of Part I of To Kill a Mockingbird. Discuss how they change and grow and what
A new predator is introduced into the ecosystem shown in the food web below. This predator feeds on bees and mice. How will this most likely affect the specie
List and briefly describe each of the five strength training principles. (Site 1)
Why is the answer for #6 A?
The process through which thoughts and actions become routine is ______.