kangasc4802 kangasc4802

04-02-2018
English

contestada

What does the dream in "dream variations" represent? question 13 options:?

Respuesta :

rockyo2000p3p3sq rockyo2000p3p3sq

05-02-2018

Represents Kings dream tp have a free america

Answer Link

ashycat13 ashycat13

08-03-2019

The speaker's longing for a place where he can express himself freely.

(I am quite sure)

Answer Link

Otras preguntas

Two sides of a triangle have the following measure of 7,8.what is the range of possiable values for the 3rd side?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

will give thanks and brainliest What is an informed opinion? an opinion that you agree with an opinion that you don’t agree with an opinion that can be argued

Monocytes are a type of white blood cell that can differentiate into what two cells?

Why silk is called queen of fiber?

Between 1920 and 1930, almost a million african american's left the south for the "promised land" up north during the

A pp plant is making gametes. how many types of gametes, and in what proportions, will there be

the organ procurement and transplant network divides the united states into geographic regions

Researchers are exploring whether treatment with ________ might improve social behavior in those with asd.

The degree measure of angle a is 135°. which expression below is equivalent to the radian measure of angle a?