MaKayla130 MaKayla130

15-11-2020
Social Studies

contestada

Why was there no tool that identified the measurement of longitude?

Respuesta :

1071649 1071649

16-11-2020

Answer:

they used a tool called sextant that would determine there latiudinal postion.

Explanation:

Used to measure the distance from East to West from Greenland,England.

Answer Link

Otras preguntas

Marla is making 6 bracelets for her friends, and she needs of a foot of string for each bracelet. How many feet of string does she need

write an argumentative essay about education

16% of a number is 60. What is that number? A375 B 432 C 456 D753

Chicago is a city that is fierce as a dog with tongue lapping for action? A)simile B)metaphor C)alliteration D)hyperbole

List the tools available to a president as he uses his power to persuade

The system of linear equations 5x+3y=3 and X+y=-1 is graphed below. What is the solution to the system of equations? O (4,3) O 1-3.4)

Please answer it’s due today.

Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG

A rectangular prism has dimensions of 2 ft, 4 ft, and 6 ft. If the dimensions are doubled, what would happen to the volume?

what started the wildfires