kayurm0m2365 kayurm0m2365

14-06-2022
Geography

contestada

what is the key factor in mexico’s climate. A. coastline B. elevation C. population destiny D. ocean current

Respuesta :

fmcruz6605 fmcruz6605

14-06-2022

Answer:

the answer is the elevation

Answer Link

Otras preguntas

Use the figure to decide the type of angle pair that describes <3 and <2.

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

What did the South fear would happen if the North had an increased number of representatives in the House of Representatives? A. The House would vote to close d

....................

As current increases in an electromagnet’s coil, the strength of the magnet field _______(increases, decreases, remains the same)

what are the most common living things on Earth?

someone please help me this is the only question stopping me from graduatin class 2020

In ΔIJK, the measure of ∠K=90°, IK = 39, JI = 89, and KJ = 80. What ratio represents the sine of ∠I?

A Mid Summer Night’s Dream by Shakespeare essay ?

help please I'd definitely appreciate it & stay safe & wash your hands .Solve the equation for x:-2x = 1/3